top of page

La ARN-polimerasa Thermo Scientific Bacteriophage T3 es una ARN polimerasa dependiente del ADN con una especificidad estricta para sus promotores de doble cadena. Cataliza la síntesis de 5'→3’ de ARN en ADN monocatenario o bicatenario posterior a su promotor y es capaz de incorporar nucleótidos modificados.

Aspectos destacados

• Incorpora nucleótidos modificados (por ejemplo, nucleótidos etiquetados con aminoalilo, biotina, fluoresceína, digoxigenina)

Aplicaciones

• Síntesis de ARN etiquetado y no etiquetado que puede usarse:
• Para hibridación, traducción in vitro de ARN
• Como ARNa, ARNip, sustrato en ensayos de protección de ARNasa, plantilla para secuenciación de ADN genómico
• En estudios de interacciones de estructura secundaria de ARN y ARN-proteína, empalme de ARN

Nota

Secuencia promotora de consenso:
T3: AATTAACCCTCACTAAAGGGAGA
La posición en negrita (+ 1) indica el primer nucleótido incorporado al ARN durante la transcripción. Solo las bases que van de esta posición a la + 3 resultan decisivas para la transcripción, y deben ser una guanina y una base púrica, respectivamente.

T3 RNA Polymerase (20 U/µL) 2,000 units

SKU: EP0101
€37.54Price
  • No incluido

  • A consultar

Página del producto: Stores_Product_Widget
bottom of page